EST details — SGN-E300583

Search information 
Request: 300583Match: SGN-E300583
Request From: Random SelectionMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87134Clone name: cLET-45-G24
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C185088 is on microarray TOM1: SGN-S1-1-3.4.12.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185088 [TUS-46-H14] Trace: SGN-T192011 EST: SGN-E390685 Direction: 5' Facility: INRA
Clone: SGN-C185088 [TUS-46-H14] Trace: SGN-T192262 EST: SGN-E390936 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300583Length: 528 bp (1022 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300583 [] (trimmed) AAACTTATGGAGGTTGGTACTGAATGGGCGCCATTGAGTACCATTACCCACCTCCACCACCCTTAATTGACCCTGAAGAGTTAGGAAAATGGTCA
TTTTACAGAGCTATAATTGCTGAATTCATAGCTACTCTGTTATTTCTCTACATAACTGTCCTTACTGTTATTGGCTACAAAAGCCAGAGCTCCAC
TGATCAATGTGGTGGAGTTGGTGTTCTTGGAATCGCTTGGGCATTTGGGGGTATGATCTTTGTACTTGTTTACTGTACTGCGGGTATTTCTGGTG
GACACATTAACCCTGCTGTTACATTTGGTCTTTACTTAGCTCGAAAAGTATCGTTGGTTCGAGCTATCATGTACATTGTAGCTCAATGTTTATGA
GCCATTTGTGGTTGTGGATTAGTAAAAGCTTTTCAAAAAGCTTATTATGTCAAATATGGCGGTGGTGCCAATACGTTGAACGATGGATATAGTAC
TGGTACTGGTTTGGGTGCAGAGATCATTGGAACATTCGTTCTTGTTTACACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300583] SGN-U581554 Tomato 200607 Build 2 64 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111755 [Download] [View] Facility Assigned ID: TMEGV48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0234 Quality Trim Threshold: 14.5